Skip to main content

Table 1 Primers used for amplification and direct sequencing analysis of the human CYP1A1 gene

From: Genetic polymorphisms of human cytochrome P450 CYP1A1 in an Egyptian population and tobacco-induced lung cancer

Primers Primer sequence (5′–3′ orientation) Location Amplified exon
1A1 ex1-S CCGAGTCCTGGTAGGCTGTA 5′-fanking Exon 1
1A1 ex1-A CCTGCAGTTGGCAATCTGTC intron 1
1A1 ex2-S CCCACAGTGGTAGTTCAACA intron 1 Exon 2
1A1 ex2-A CCCTGCCAAGGAAGAAGACT intron 2
1A1 ex3-S AGAGCCTTGCAGAGGCAGAG intron 2 Exons 3–6
1A1 ex6-A GGCAATGGTCTCACCGATAC exon 6
1A1 I462V-S GCTGCTTGCCTGTCCTCTAT intron 6 Exon 7a
1A1 I462V-A AGGCATGCTTCATGGTTAGC exon 7
1A1 ex7-S AGCTATGGGTCAACCCATCT exon 7 Exon 7b
1A1 ex7-A TCTTCTTCCTCCCTACAGTA intron 7