Skip to main content

Table 1 Oligodeoxyribonucleotides used in this study

From: Analysis of large deletion mutations induced by abasic site analog in human cells

Name Sequence (5′- > 3′)a
ODN-1 P-CGACTTCGAAGGTTCGAATCC
ODN-2 P-CGACTTCGAAGOTTCGAATCC
ODN-3 P-CGACTTCGAAGFTTCGAATCC
ODN-4 P-TCCGAAAGAATTGAGCGTCAGA
ODN-5 P-TCCGAAAGAATTFAGCGTCAGA
ODN-seq1 GGCGGTGCTACAGAGTTCTT
ODN-seq2 GCACCCAACTGATCTTCAGC
  1. aF, O, and P represent THF, GO, and the phosphate, respectively