Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Forward and reverse primers used for construction of pMMP-2sh vector

From: Effect of MMP-2 gene silencing on radiation-induced DNA damage in human normal dermal fibroblasts and breast cancer cells

S.No Gene Forward Primer Reverse Primer
1 MMP-2 5’GATCCGTACCTCGAGACAAATTCTGGAGATACATCAAGAGTGTATCTCCAGAATTTGTCTCTTTTTGGAAA3’ 3’CATGGAGCTCTGTTTAAGACCTCTATGTAGTTCTCACATAGAGGTCTTAAACAGAGAAAAACCTTTTCGA5’