Effects of the scid mutation on X-ray-induced deletions in the brain and spleen of gpt delta mice

Masumura, Kenichi; Yatagai, Fumio; Ochiai, Masako; Nakagama, Hitoshi; Nohmi, Takehiko

doi:10.1186/s41021-020-00158-y

Genes and Environment

Table 2 Summary of Spi⁻ mutations in the brain of X-ray-irradiated WT and scid mice

From: Effects of the scid mutation on X-ray-induced deletions in the brain and spleen of gpt delta mice

Types of deletions	Position	Position	Sequence	Sequence	No. of mutants
	in gam	in lambda EG10	Change ^a	at junction ^b,c	WT	scid	WT	scid
	in gam	in lambda EG10	Change ^a	at junction ^b,c	0 Gy	0 Gy	10 Gy	10 Gy
One base pair deletions
In run sequences
	141–142		GG→G				1
	188–190		CCC→CC					1
	199–201		AAA→AA				1
	227–231		AAAAA→AAAA		5^d	1	5^d	11^d
	238–241		CCCC→CCC		2^d	1	1	2^d
	286–289		GGGG→GGG		5^d	1	3^d	12^d
	290–291		CC→C				1	1
	295–300		AAAAAA→AAAAA		6^d	3^d	15^d	9^d
	316–318		TTT→TT				1
	334–336		TTT→TT					2
	377–378		CC→C					1
	380–381		TT→T				1
	387–388		CC→C				1
	390–391		CC→C					1
Other 1 bp deletion
	131		ttAtt→tttt					1
	175		cacTac→cacac					1
	183		caGct→cact					1
	203		gAgg→ggg					1
	218		agAcg→agcg		1
	236		ccTgc→ccgc					1
	268		tcGat→tcat				1
	276		tttG→ttt				1
	277		ttgCaac→ttgaac					2^d
	285		Cgggg→gggg				1
	294		Caaaaaa→aaaaaa		1
	301		aaaaaaT→aaaaaa					1
	320		tttgAt→tttgt					1
	328		tGtt→ttt					1
	332		gAg→gg				1
	341		ggAg→ggg				1
	392		ccAgg→ccgg				1
> 2 bp deletions
Deleted sizes (bp)
2	153 → 156			tgag tcag			1
2	251 → 254			tgtt aatc				1
2	349 → 352			atgg gaac			1
3	355 → 359			gaac tccg				1
4	182–184 → 187–189			agcaGCccgt			1
4	222 → 227			cgac aaaa				1
4	239–240 → 244–245			tgccCacct				1
4	247–249 → 251–253			caccTgaat			1
4	295–300			cagcAAtcca				1
4	304 → 309			tcca ccgt				1
5	300–301 → 306–307			aaaaTaccc				2
7	147–149 → 155–157			tcgtCTcaga				1
7	349–351 → 357–359			atggCAtccg			1
8	175 → 184			cact ctcg			1
10	196–198 → 207–209			gaagAGaact			1
10	323 → 334			atga tttc			1
10	335 → 346			agtt atgg			1
10	375–379 → 386–390			tgaaACcacc			1
12	221–222 → 234–235			acgaCctgc				1
12	313 → 326			cgtg atgt			1
13	376–379 → 389–392			gaaaCCAggtt			1
14	165–167 → 180–182			ctggGcagc			1
17	154–155 → 172–173			gaggCacta			1
17	239–240 → 257–258			ctgcCgcta				1
17	251 → 269			tgtt atca				1
19	212–215 → 232–235			aactGGCctgc				1
22	288–289 → 311–312			cgggGtgcg				3
26	268 → 285			atcg cggg				2^d
28	307 → 336			atta tcag			1
28	338 → 367			ttca atgg		1
32	189–190 → 222–223			cgccCatgg			1
34	346–348 → 381–383			cgcaTGctca			1
41	380 → 422			ccat aatg				1
49	206 → 257 (1 bp ins.)			aggc C cgct			1
67	246–247 → 314–315			gcacCgttt				1
76	189 → 266			cgcc tcga			1
86	252–253 → 339–340			gtttGgagc			1
107	91–92 → 199–200			cgatAaaga			1
124	208 → 333			gcag gttt				1
127	273–276 → 401–404			tcatTTGattc				1
151		24,867–24,870 → 25,019–25,022		cgacACGcacg			1
432		24,828–24,830 → 25,261–25,263		gagtGGgctg				1
449		24,683–24,684 → 25,133–25,134		cccaCtttc				1
596		24,446–24,450 → 25,043–25,047		ataTGGCcccg				1
654		24,719 → 25,374		aagg tcgc				1
1248		24,524–24,536 → 25,767–25,779		aatgGTTCGCGGCGGCgtg				2
1436		24,563 → 26,000		caga cagt		1
1557		24,222 → 25,802 (22 bps ins.)		tgtc *CATTCAAAACACACCACCAAAG* ctcc				1
1616		23,938–25,555 (2 bps ins.)		aaac AG gcct			1
1856		23,960–23,961 → 25,817–25,818		gaagTtggt			1
1874		24,161–24,162 → 26,009–26,010		tgttTgctg			1
2124		23,141 → 25,266 (1 bp ins.)		tcgg A gatt				2
2388		23,000–23,004 → 25,389–25,393		tgctGCGAtag				1
2388		24,000–24,002 → 28,232–28,234		gggGTgtca				1
2441		24,034–24,035 → 26,476–26,477		cggtGccag				1
2842		24,247–24,248 → 27,090–27,091		agcGccga				1
3628		25,062 → 28,691		aaa ctg			1
3701		24,560 → 28,262		gatg gcac				1
3707		21,458–21,459 → 25,166–25,167		attGcgcc				1
3979		22,200–22,204 → 26,180–26,184		ccagTTTAtttt			2
4144		22,585–22,586 → 26,730–26,731		cgttCtgcc				1
4689		23,611–23,612 → 28,301–28,302		agttGcgcg			1
4698		24,423–24,424 → 29,122–29,123		gaaGtgcc				1
4841		21,691–21,692 → 26,533–26,534		agacAtcat			1
5037		21,355 → 26,393		ctct agaa			1
5251		19,712–19,713 → 24,964–24,965		caccAccat			1
5422		22,340 → 27,760 (3 bps ins.)		cgcc *TTT* caca				1
5562		19,997 → 25,560		atag gatt	1
5727		19,335 → 25,063		tggc tgat			1
6900		24,036 → 30,937		gtga gatc			1
7303		23,917 → 31,221		cttc tcgt	1
9030		21,854–21,857 → 30,885–30,888		gagtACGcttt			1
Insertions
+ 1	227–231		AAAAA→AAAAAA		1
+ 1	227–231		AAAAA→AAAAAA					1
+ 1	295–300		AAAAAA→AAAAAAA					4^d
+ 1	356		aaca→aacTa		1
Complex
N.D.		23,999 → 24,381, 23,997–23,996 → 27,762–27,763				1
N.D.		21,108–21,109 → 13–14					1
					25	8	72	95

^a Capital letters are deleted or Inserted bases
^b Bold and underlined bases denote homologous sequences of deletion junctions
^c Bold and italic bases denote inserted sequences at deletion junctions
^d The mutations were independently observed from more than two different mice

Back to article page

ISSN: 1880-7062

Contact us

Submission enquiries: Access here and click Contact Us
General enquiries: info@biomedcentral.com