Skip to main content

Table 2 Summary of Spi mutations in the brain of X-ray-irradiated WT and scid mice

From: Effects of the scid mutation on X-ray-induced deletions in the brain and spleen of gpt delta mice

Types of deletions Position Position Sequence Sequence No. of mutants
in gam in lambda EG10 Change a at junction b,c WT scid WT scid
0 Gy 0 Gy 10 Gy 10 Gy
One base pair deletions
 In run sequences
  141–142   GG→G     1  
  188–190   CCC→CC      1
  199–201   AAA→AA     1  
  227–231   AAAAA→AAAA   5d 1 5d 11d
  238–241   CCCC→CCC   2d 1 1 2d
  286–289   GGGG→GGG   5d 1 3d 12d
  290–291   CC→C     1 1
  295–300   AAAAAA→AAAAA   6d 3d 15d 9d
  316–318   TTT→TT     1  
  334–336   TTT→TT      2
  377–378   CC→C      1
  380–381   TT→T     1  
  387–388   CC→C     1  
  390–391   CC→C      1
 Other 1 bp deletion
  131   ttAtt→tttt      1
  175   cacTac→cacac      1
  183   caGct→cact      1
  203   gAgg→ggg      1
  218   agAcg→agcg   1    
  236   ccTgc→ccgc      1
  268   tcGat→tcat     1  
  276   tttG→ttt     1  
  277   ttgCaac→ttgaac      2d
  285   Cgggg→gggg     1  
  294   Caaaaaa→aaaaaa   1    
  301   aaaaaaT→aaaaaa      1
  320   tttgAt→tttgt      1
  328   tGtt→ttt      1
  332   gAg→gg     1  
  341   ggAg→ggg     1  
  392   ccAgg→ccgg     1  
>  2 bp deletions  
 Deleted sizes (bp)
  2 153 → 156    tgag tcag    1  
  2 251 → 254    tgtt aatc     1
  2 349 → 352    atgg gaac    1  
  3 355 → 359    gaac tccg     1
  4 182–184 → 187–189    agcaGCccgt    1  
  4 222 → 227    cgac aaaa     1
  4 239–240 → 244–245    tgccCacct     1
  4 247–249 → 251–253    caccTgaat    1  
  4 295–300    cagcAAtcca     1
  4 304 → 309    tcca ccgt     1
  5 300–301 → 306–307    aaaaTaccc     2
  7 147–149 → 155–157    tcgtCTcaga     1
  7 349–351 → 357–359    atggCAtccg    1  
  8 175 → 184    cact ctcg    1  
  10 196–198 → 207–209    gaagAGaact    1  
  10 323 → 334    atga tttc    1  
  10 335 → 346    agtt atgg    1  
  10 375–379 → 386–390    tgaaACcacc    1  
  12 221–222 → 234–235    acgaCctgc     1
  12 313 → 326    cgtg atgt    1  
  13 376–379 → 389–392    gaaaCCAggtt    1  
  14 165–167 → 180–182    ctggGcagc    1  
  17 154–155 → 172–173    gaggCacta    1  
  17 239–240 → 257–258    ctgcCgcta     1
  17 251 → 269    tgtt atca     1
  19 212–215 → 232–235    aactGGCctgc     1
  22 288–289 → 311–312    cgggGtgcg     3
  26 268 → 285    atcg cggg     2d
  28 307 → 336    atta tcag    1  
  28 338 → 367    ttca atgg   1   
  32 189–190 → 222–223    cgccCatgg    1  
  34 346–348 → 381–383    cgcaTGctca    1  
  41 380 → 422    ccat aatg     1
  49 206 → 257 (1 bp ins.)    aggc C cgct    1  
  67 246–247 → 314–315    gcacCgttt     1
  76 189 → 266    cgcc tcga    1  
  86 252–253 → 339–340    gtttGgagc    1  
  107 91–92 → 199–200    cgatAaaga    1  
  124 208 → 333    gcag gttt     1
  127 273–276 → 401–404    tcatTTGattc     1
  151   24,867–24,870 → 25,019–25,022   cgacACGcacg    1  
  432   24,828–24,830 → 25,261–25,263   gagtGGgctg     1
  449   24,683–24,684 → 25,133–25,134   cccaCtttc     1
  596   24,446–24,450 → 25,043–25,047   ataTGGCcccg     1
  654   24,719 → 25,374   aagg tcgc     1
  1248   24,524–24,536 → 25,767–25,779   aatgGTTCGCGGCGGCgtg     2
  1436   24,563 → 26,000   caga cagt   1   
  1557   24,222 → 25,802 (22 bps ins.)   tgtc CATTCAAAACACACCACCAAAG ctcc     1
  1616   23,938–25,555 (2 bps ins.)   aaac AG gcct    1  
  1856   23,960–23,961 → 25,817–25,818   gaagTtggt    1  
  1874   24,161–24,162 → 26,009–26,010   tgttTgctg    1  
  2124   23,141 → 25,266 (1 bp ins.)   tcgg A gatt     2
  2388   23,000–23,004 → 25,389–25,393   tgctGCGAtag     1
  2388   24,000–24,002 → 28,232–28,234   gggGTgtca     1
  2441   24,034–24,035 → 26,476–26,477   cggtGccag     1
  2842   24,247–24,248 → 27,090–27,091   agcGccga     1
  3628   25,062 → 28,691   aaa ctg    1  
  3701   24,560 → 28,262   gatg gcac     1
  3707   21,458–21,459 → 25,166–25,167   attGcgcc     1
  3979   22,200–22,204 → 26,180–26,184   ccagTTTAtttt    2  
  4144   22,585–22,586 → 26,730–26,731   cgttCtgcc     1
  4689   23,611–23,612 → 28,301–28,302   agttGcgcg    1  
  4698   24,423–24,424 → 29,122–29,123   gaaGtgcc     1
  4841   21,691–21,692 → 26,533–26,534   agacAtcat    1  
  5037   21,355 → 26,393   ctct agaa    1  
  5251   19,712–19,713 → 24,964–24,965   caccAccat    1  
  5422   22,340 → 27,760 (3 bps ins.)   cgcc TTT caca     1
  5562   19,997 → 25,560   atag gatt 1    
  5727   19,335 → 25,063   tggc tgat    1  
  6900   24,036 → 30,937   gtga gatc    1  
  7303   23,917 → 31,221   cttc tcgt 1    
  9030   21,854–21,857 → 30,885–30,888   gagtACGcttt    1  
Insertions
  + 1 227–231   AAAAA→AAAAAA   1    
  + 1 227–231   AAAAA→AAAAAA      1
  + 1 295–300   AAAAAA→AAAAAAA      4d
  + 1 356   aaca→aacTa   1    
Complex
 N.D.   23,999 → 24,381, 23,997–23,996 → 27,762–27,763     1   
 N.D.   21,108–21,109 → 13–14      1  
      25 8 72 95
  1. a Capital letters are deleted or Inserted bases
  2. b Bold and underlined bases denote homologous sequences of deletion junctions
  3. c Bold and italic bases denote inserted sequences at deletion junctions
  4. d The mutations were independently observed from more than two different mice