Skip to main content

Table 2 RT qPCR primers

From: DNA hypomethylation drives changes in MAGE-A gene expression resulting in alteration of proliferative status of cells

Gene Forward primer Reverse primer
MAGEA1 caacccagaggacaggattc gggcaatgaagacccaca
MAGEA2 atgaacgggctttgagagag gaggcagtggaagctaatgg
MAGEA3/A6 gtgaggaggcaaggttctga gggcaatggagacccact
MAGEA4 acagaggagcaccaaggaga cagcaggcaagagtgcag
MAGEA5 agaggagcaccaaaggagaa actctggtcaccgcaacag
MAGEA8 cactcctacatccttgtcacctg ggtcttgggcgtactctgat
MAGEA9 ggagaggcctccttctgag tctgcgacctgaggacact
MAGEA10 gttctgagggacaggcttga gtcaccctctgagagcaagg
MAGEA11 tctttctgaggggtgtcttgag gaactgagtctccatccctcag
MAGEA12 gattctcgccctgagcaa gggcctgtctcctcagaac
MAGEA1 (CDS) gagtccttgttccgagcagt aggagcagaaaaccaaccaa
MAGEA2 (CDS) caatagagggcgactgtgc ccctcaaacacctccaacat
MAGEA3/A6 (CDS) aaggtggccaagttggttc gcatttctgcctttgtgacc
MAGEA4 (CDS) cgcctctgaggaggaaatct ccaatcttgggtgagcagtt
MAGEA9 (CDS) ttcatgcaggtgatctttgg acgagaggccaagagcagt
MAGEA10 (CDS) gccactcctttgtccttgtc gggcatgctctggacatc
MAGEA11 (CDS) gtgggtgcacaggctctc gcccacattcagagtagagga
MAGEA12 (CDS) ctctctggagtcaatccgatg caggtcaggaaaggtgcttg
MAGED2 ccagcaagatgaaagtcctca tccatcgcctctcggtact
RpLp (housekeeping gene) tctacaaccctgaagtgcttgat caatctgcagacagacactgg