Skip to main content

Table 1 List of targeted genes, site of mutations, and design of gRNA

From: Preparation of the standard cell lines for reference mutations in cancer gene-panels by genome editing in HEK 293 T/17 cells

GeneNCC Oncopanel (ver 2)Thermo Fisher Oncomine Dx TestPersonails ACE CancerPlus™ TestIllumina Trusight Tumor 26Ion AmpliSeq Cancer Hotspot Panel v2No of mutations in COSMICCOSMIC_IDCDS MutationFATHMMgRNA sequense(No of mismatch)
Distanse from PAM0123
AKT1*****975COSM3376549G > APathogenic(score 1.00)CACCACCCGCACGTCTGTAGGGG111112
AKT3* *  269COSM242892232C > APathogenic (score 0.99) TCTCTATAACAGTAGTCCACTGG110027
ALK*****1522COSM280563824G > APathogenic(score 0.98)TACTCACCTGTAGATGTCTCGGG411116
BAP1* *  1221COSM110721178C > TPathogenic(score 0.98)CCAAGGTAGAGACCTTTCGCCGG51119
BCL2L11(BIM)* *  116COSM389356585G > CPathogenic (score 0.98) GTTACATTGTCCGCCTGGTGTGG11007
BRAF***>**27,630COSM4761799 T > APathogenic (score 0.99) TAGCTACAGTGAAATCTCGATGG1210120
BRAF’*****4COSM11371817G > APathogenic (score 0.98) ACAGTGAAATCTCGATGGAGTGG111025
CDK4***  101COSM167713970C > TPathogenic(score 0.98)AGTGGCCACTGTGGGGATCACGG211245
CDKN2A(p16)*** *5911COSM12475238C > TPathogenic(score 0.88)GGGCAGCGTCGTGCACGGGTCGG21114
CTNNB1(β-catenin)*****7307COSM5664121A > GPathogenic(score 0.98)CAGAGAAGGAGCTGTGGTAGTGG61111195
DNMT3A **  3679COSM529442645G > APathogenic(score 0.98)CGTCTCCAACATGAGCCGCTTGG611218
ERBB2(HER2)*****1596COSM48358929C > TPathogenic(score 0.97)CAGGGGGCAGACGAGGGTGCAGG11121201
ERBB3***  900COSM20710310G > APathogenic(score 0.88)ACCATTGCCCAACCTCCGCGTGG41117
EZH2*** *1273COSM370281937A > TPathogenic(score 0.99)GAATTCATCTCAGAATACTGTGG711577
FBXW7** **1972COSM229751513C > TPathogenic(score 0.94)TGCCATCATATTGAACACAGCGG211118
FGFR3*** *4354COSM715746C > GPathogenic(score 0.96)CTGCAGGATGGGCCGGTGCGGGG124758
FOXL2 * * 933COSM33661402C > GPathogenic(score 0.95)CTTCTCGAACATGTCTTCGCAGG511112
HRAS*** *2023COSM502183G > Tnone(score 0.53)CATCCTGGATACCGCCGGCCAGG222216
IDH2*** *2430COSM33733515G > APathogenic(score 0.99)CCAAGCCCATCACCATTGGCAGG211486
IGF2*    132COSM1561457293C > TPathogenic (score 0.97) ACCCTCACCGGAAGCACGGTCGG21001
JAK2*** *50,556COSM126001849G > TPathogenic(score 0.94)AATTATGGAGTATGTGTCTGTGG811175
KIT*****8856COSM13142447A > TPathogenic(score 0.99)AGAATCATTCTTGATGTCTCTGG7111133
KNSTRN *   118COSM14005671C > TNeutral(score 0.00)GTAGCTAGGCGGAAGTGGGTGGG111228
KRAS*****43,548No ID124G > A CTTGTGGTAGTTGGAGCTGGTGG411146
MAGOH *   43COSM535605410 T > CPathogenic(score 0.99)TGTTTGGTCTTCAGTCTTATTGG412376
MAP 2 K1**** 496COSM235614370C > TPathogenic(score 0.99)CCATAGAAGCCCACGATGTACGG114410
MAPK1 **  173COSM461148964G > APathogenic(score 0.98)GTATTACGACCCGAGTGACGAGG41112
MDM2* *  110COSM431747994C > TPathogenic(score 0.91)AGGAAGCCAATTCTCACGAAGGG611225
MET*****1142COSM7073029C > TPathogenic(score 0.98)TTTGAAACCATTTCTGTAGTTGG511278
MTOR***  1195COSM204176644C > APathogenic(score 1.00)CCAATGACCCAACATCTCTTCGG811112
MYCN*    305COSM35624131C > TPathogenic (score 0.96) CTTCCAGATGTCCTCCCCCGGGG110024
NOTCH1*** *3921COSM127714799 T > CPathogenic(score 0.99)CCACGTTGGTGTGCAGCACGCGG911153
NRAS*****6676COSM5930625112G > APathogenic(score 0.99)AAACTGGTGGTGGTTGGAGCAGG111167
PDGFRA*****2354COSM7362525A > TPathogenic(score 0.99)CGAATCATGCATGATGTCTCTGG711124
PIK3CA*****13,613COSM7753140A > GPathogenic(score 0.96)ATGAATGATGCACATCATGGTGG110156
PTCH1***  1331COSM16383943944C > TPathogenic(score 1.00)AGCGTCTCTGCGCGGTCTGTAGG11117
PTEN*****4778No ID697C > T AACTTGTCTTCCCGTCGTGTGGG71017
SMO*** *593COSM2160371234C > TPathogenic(score 0.96)AGCCTCCCACGATGAGCACCAGG8111102
STAT3**   805COSM11557431919A > TPathogenic(score 0.97)TTCAGCTGCTGCTTTGTGTATGG511692
TP53(p53)*****39,196COSM10662743G > APathogenic(score 0.98)GCATGGGCGGCATGAACCGGAGG51003