Skip to main content

Table 1 List of targeted genes, site of mutations, and design of gRNA

From: Preparation of the standard cell lines for reference mutations in cancer gene-panels by genome editing in HEK 293 T/17 cells

Gene NCC Oncopanel (ver 2) Thermo Fisher Oncomine Dx Test Personails ACE CancerPlus™ Test Illumina Trusight Tumor 26 Ion AmpliSeq Cancer Hotspot Panel v2 No of mutations in COSMIC COSMIC_ID CDS Mutation FATHMM gRNA sequense (No of mismatch)
Distanse from PAM 0 1 2 3
AKT1 * * * * * 975 COSM33765 49G > A Pathogenic (score 1.00) CACCACCCGCACGTCTGTAGGGG 1 1 1 1 12
AKT3 *   *    269 COSM242892 232C > A Pathogenic (score 0.99)   TCTCTATAACAGTAGTCCACTGG 1 1 0 0 27
ALK * * * * * 1522 COSM28056 3824G > A Pathogenic (score 0.98) TACTCACCTGTAGATGTCTCGGG 4 1 1 1 16
BAP1 *   *    1221 COSM110721 178C > T Pathogenic (score 0.98) CCAAGGTAGAGACCTTTCGCCGG 5 1 1 1 9
BCL2L11(BIM) *   *    116 COSM389356 585G > C Pathogenic (score 0.98)   GTTACATTGTCCGCCTGGTGTGG 1 1 0 0 7
BRAF * * *> * * 27,630 COSM476 1799 T > A Pathogenic (score 0.99)   TAGCTACAGTGAAATCTCGATGG 12 1 0 1 20
BRAF’ * * * * * 4 COSM1137 1817G > A Pathogenic (score 0.98)   ACAGTGAAATCTCGATGGAGTGG 1 1 1 0 25
CDK4 * * *    101 COSM1677139 70C > T Pathogenic (score 0.98) AGTGGCCACTGTGGGGATCACGG 2 1 1 2 45
CDKN2A(p16) * * *   * 5911 COSM12475 238C > T Pathogenic (score 0.88) GGGCAGCGTCGTGCACGGGTCGG 2 1 1 1 4
CTNNB1(β-catenin) * * * * * 7307 COSM5664 121A > G Pathogenic (score 0.98) CAGAGAAGGAGCTGTGGTAGTGG 6 1 1 11 195
DNMT3A   * *    3679 COSM52944 2645G > A Pathogenic (score 0.98) CGTCTCCAACATGAGCCGCTTGG 6 1 1 2 18
ERBB2(HER2) * * * * * 1596 COSM48358 929C > T Pathogenic (score 0.97) CAGGGGGCAGACGAGGGTGCAGG 1 1 1 21 201
ERBB3 * * *    900 COSM20710 310G > A Pathogenic (score 0.88) ACCATTGCCCAACCTCCGCGTGG 4 1 1 1 7
EZH2 * * *   * 1273 COSM37028 1937A > T Pathogenic (score 0.99) GAATTCATCTCAGAATACTGTGG 7 1 1 5 77
FBXW7 * *   * * 1972 COSM22975 1513C > T Pathogenic (score 0.94) TGCCATCATATTGAACACAGCGG 2 1 1 1 18
FGFR3 * * *   * 4354 COSM715 746C > G Pathogenic (score 0.96) CTGCAGGATGGGCCGGTGCGGGG 1 2 4 7 58
FOXL2   *   *   933 COSM33661 402C > G Pathogenic (score 0.95) CTTCTCGAACATGTCTTCGCAGG 5 1 1 1 12
HRAS * * *   * 2023 COSM502 183G > T none (score 0.53) CATCCTGGATACCGCCGGCCAGG 2 2 2 2 16
IDH2 * * *   * 2430 COSM33733 515G > A Pathogenic (score 0.99) CCAAGCCCATCACCATTGGCAGG 2 1 1 4 86
IGF2 *      132 COSM1561457 293C > T Pathogenic (score 0.97)   ACCCTCACCGGAAGCACGGTCGG 2 1 0 0 1
JAK2 * * *   * 50,556 COSM12600 1849G > T Pathogenic (score 0.94) AATTATGGAGTATGTGTCTGTGG 8 1 1 1 75
KIT * * * * * 8856 COSM1314 2447A > T Pathogenic (score 0.99) AGAATCATTCTTGATGTCTCTGG 7 1 1 1 133
KNSTRN   *     118 COSM140056 71C > T Neutral (score 0.00) GTAGCTAGGCGGAAGTGGGTGGG 1 1 1 2 28
KRAS * * * * * 43,548 No ID 124G > A   CTTGTGGTAGTTGGAGCTGGTGG 4 1 1 1 46
MAGOH   *     43 COSM535605 410 T > C Pathogenic (score 0.99) TGTTTGGTCTTCAGTCTTATTGG 4 1 2 3 76
MAP 2 K1 * * * *   496 COSM235614 370C > T Pathogenic (score 0.99) CCATAGAAGCCCACGATGTACGG 1 1 4 4 10
MAPK1   * *    173 COSM461148 964G > A Pathogenic (score 0.98) GTATTACGACCCGAGTGACGAGG 4 1 1 1 2
MDM2 *   *    110 COSM431747 994C > T Pathogenic (score 0.91) AGGAAGCCAATTCTCACGAAGGG 6 1 1 2 25
MET * * * * * 1142 COSM707 3029C > T Pathogenic (score 0.98) TTTGAAACCATTTCTGTAGTTGG 5 1 1 2 78
MTOR * * *    1195 COSM20417 6644C > A Pathogenic (score 1.00) CCAATGACCCAACATCTCTTCGG 8 1 1 1 12
MYCN *      305 COSM35624 131C > T Pathogenic (score 0.96)   CTTCCAGATGTCCTCCCCCGGGG 1 1 0 0 24
NOTCH1 * * *   * 3921 COSM12771 4799 T > C Pathogenic (score 0.99) CCACGTTGGTGTGCAGCACGCGG 9 1 1 1 53
NRAS * * * * * 6676 COSM5930625 112G > A Pathogenic (score 0.99) AAACTGGTGGTGGTTGGAGCAGG 1 1 1 1 67
PDGFRA * * * * * 2354 COSM736 2525A > T Pathogenic (score 0.99) CGAATCATGCATGATGTCTCTGG 7 1 1 1 24
PIK3CA * * * * * 13,613 COSM775 3140A > G Pathogenic (score 0.96) ATGAATGATGCACATCATGGTGG 1 1 0 1 56
PTCH1 * * *    1331 COSM1638394 3944C > T Pathogenic (score 1.00) AGCGTCTCTGCGCGGTCTGTAGG 1 1 1 1 7
PTEN * * * * * 4778 No ID 697C > T   AACTTGTCTTCCCGTCGTGTGGG 7 1 0 1 7
SMO * * *   * 593 COSM216037 1234C > T Pathogenic (score 0.96) AGCCTCCCACGATGAGCACCAGG 8 1 1 1 102
STAT3 * *     805 COSM1155743 1919A > T Pathogenic (score 0.97) TTCAGCTGCTGCTTTGTGTATGG 5 1 1 6 92
TP53(p53) * * * * * 39,196 COSM10662 743G > A Pathogenic (score 0.98) GCATGGGCGGCATGAACCGGAGG 5 1 0 0 3