Skip to main content

Table 3 List of primers sequences used for amplification of deletion cassette

From: Genetic interaction between RLM1 and F-box motif encoding gene SAF1 contributes to stress response in Saccharomyces cerevisiae

Gene Name Primer code Sequence
SAF1 SAF1F 5’CCAAAGGATATACTCTCAATTATAAATGA
AAGCACATCCGGATCCCCGGGTTAATTAA-3’
SAF1R 5’ACGGAATCCAAAATGCAAAATCGAAATGA
CACCTAAAAA TGAATTCGAGCTCGTTTAAAC-3’
RLM1 RLM1F 5’TAAATATTAAAGTGTCGCAAAACTATACTA
TAGATACAACCGGATCCCCGGGTTAATTAA-3’
RLM1R 5’TCTTATGCTTGGAATATTCATACTGGTCAA
ATTTTTTGGTGAATTCGAGCTCGTTTAAAC-3’
RLM1 RLM1FL 5’TAAATATTAAAGTGTCGCAAAACTATACTA
TAGATACAACCCAACTGTGGGAATACTCAG-3
RLM1RL 5’TCTTATGCTTGGAATATTCATACTGGTCAA
ATTTTTTGGTTTGGCCCGAAATTCCCCTAC-3