Skip to main content

Table 3 Primer sequence table

From: NEAT1 can be a diagnostic biomarker in the breast cancer and gastric cancer patients by targeting XIST, hsa-miR-612, and MTRNR2L8: integrated RNA targetome interaction and experimental expression analysis

Gene Forward / Reverse Primer sequence
NEAT1 Forward 5’CTTCTTCCCTTTAACTTATCCATTCAC3’
Reverse 5’CTCTTCCTCCACCATTACCAACAATAC3’
GAPDH Forward 5’ACAGGGTGGTGGACCTCAT3’
Reverse 5’AGGGGTCTACATGGCAACTG3’