Skip to main content

Table 1 The name and sequence of the primers, the sizes, and annealing temperatures for each pair

From: Bisphenol A enhances adipogenic signaling pathways in human mesenchymal stem cells

GeneSize (bp)Sequence (5′ → 3′)Annealing temperature (°C)
GAPDH113F:CATGAGAAGTATGACAACAGCCT
R:AGTCCTTCCACGATACCAAAGT
58
PPARγ80F:CAGAAATGCCTTGCAGTGGG
R:AACAGCTTCTCCTTCTCGGC
59
CEBPα94F:TATAGGCTGGGCTTCCCCTT
R:AGCTTTCTGGTGTGACTCGG
60
CEBPβ154F:TTTGTCCAAACCAACCGCAC
R:GCATCAACTTCGAAACCGGC
59
SREBP1c117F:TCTCAGTCCCCTGGTCTCTG
R:ATAGGCAGCTTCTCCGCATC
59
INSIG2114F:AGTGGTCCAGTGTAATGCGG
R:TGGATAGTGCAGCCAGTGTG
60
LPL137F:GCTCAGGAGCATTACCCAGTGTC
R:GCTCCAAGGCTGTATCCCAAGA
63
FASN107F:ATTCTGCCATAAGCCCTGTC
R:CTGTGTACTCCTTCCCTTCTTG
57
  1. GAPDH Glyceraldehyde-3-phosphate dehydrogenase, PPARγ Peroxisome proliferator-activated receptor-gamma, C/EBPα CCAAT-enhancer-binding protein-alpha, C/EBPβ CCAAT-enhancer-binding protein- beta, SREBP1c Sterol regulatory element-binding protein-1c, INSIG2 Insulin induced gene-2, FASN Fatty acid synthase, LPL lipoprotein lipase