Skip to main content

Table 1 Target genes, amplicon sizes, labels, and sequences of primers and probes used in the Luminex assay

From: Gene expression analysis in NSAID-induced rat small intestinal disease model with the intervention of berberine by the liquid chip technology

Target genes Amplicon size (bp) labels Sequence (5′-3′)
HTR4 132 Forward TCCTCATGGTGCTGGCCTAT
  Reverse GATGTGTGCTGTGCTGGTCA
  Probe AACGGGCAGGAGCCACCTCTGAAAGCA
HTR1a 122 Forward CTCCACTTTCGGCGCTTTCT
  Reverse CCGCTCCCTTCTTTTCCACC
  Probe TCTTCAGAGCCGCGCGCTTCCGAAT
F2RL3 145 Forward GTACTGTTCTCGGCAGTGGC
  Reverse CTACGCAGCTGTTGAGGGTG
  Probe TATGGAGCCTATGTGCCCAGCCTGGCA
NOS1 111 Forward ATCAGCCAGCAAAGACCAGC
  Reverse TTAGCCTGGGAGACTGAGCC
  Probe TCCCAGTAACGGACCTCAGCATGCCCA
CALCA 103 Forward AACACTGCCACCTGTGTGAC
  Reverse AGGCTTCAGAGCCCACATTG
  Probe ATCGGCTGGCAGGTCTGCTGAGCAGAT
NPY 132 Forward CTGGAGGAGAGCTTGTGGGA
  Reverse CGCCTACTCCACACTCCTCA
  Probe ATCGGGCAGGAGCCACCGCTGAAATCA
CRHR2 94 Forward TTGGATGGTGCATTCCCTGC
  Reverse CCAGCTTCCTTGCCAAACCA
  Probe TCATCGCCTGGGCAGTTGGCAAACTCT
IL1b 94 Forward TCGCAGCAGCACATCAACAA
  Reverse TCCACGGGAAAGACACAGGT
  Probe TGGCTGTGGAGAAGCTGTGGCAGCT
P2RX3 93 Forward GCTGGTATACGGGAACGCTG
  Reverse AGAACAGTCCCCACTCCCAC
  Probe ACCATCATCAGCTCGGTGGCTGCCTT
NOS2 80 Forward ATCACTTCCCCGCCTAGTCC
  Reverse TCTAGCTCCTGCTGTTCGCT
  Probe TCGACTGCTCAGCACCCTGGCAGAAGA
TPH1 145 Forward TGACATCTTCCCCCTGCTGA
  Reverse CACTCTGTTGGCGCAGAAGT
  Probe ACTCGCCCGATCAGCTCACTGCGAA
CRHR1 140 Forward CCTGGCCAGCAATGTCTCTG
  Reverse TGACGGCAATGTGGTAGTGC
  Probe ATGGCTACCGGGAATGCCTGGCCAA
HMOX1 137 Forward TCTGGTATGGGCCTCACTGG
  Reverse GTCACCCAGGTAGCGGGTAT
  Probe TCATCCCTTGCACGCCAGCCACACA
TRPV1 137 Forward TCTGGTATGGGCCTCACTGG
  Reverse GTCACCCAGGTAGCGGGTAT
  Probe TCATCCCTTGCACGCCAGCCACACA
VIP 94 Forward TGGAAGCCAGAAGCAAGCCT
  Reverse GGTGGTCCAAAGAGAGGCCA
  Probe AGTGTGCTGTTCTCTCAGTCGCTGGCC
F2RL1 102 Forward TAATGGCATGGCCCTCTGGA
  Reverse ATGACAGAGAGGAGGTCGGC
  Probe ACACCCCGCCGTGATTTACATGGCCA
TGFB1 90 Forward ATACGCCTGAGTGGCTGTCT
  Reverse CGCTGAATCGAAAGCCCTGT
  Probe ACGTCACTGGAGTTGTACGGCAGTGGC
HTR3a 141 Forward ATAGACCCCCAGCCACCTTC
  Reverse CCTCCCTTGGTGGTGGAAGA
  Probe TCAGCCATGGGAAACCACTGCAGCCA
SLC6A4 91 Forward CATCTTCACGGTGCTTGGCT
  Reverse GATGAAAAGGAGGCTGGGGC
  Probe ACGAAGACGTGTCCGAGGTGGCCAAA
TFF2 133 Forward TCGGAGCAGTGTGTCATGGA
  Reverse GTGGGAAGAAACACCAGGGC
  Probe TCGCAAGAATTGTGGGTACCCGGGCA
AQP8 96 Forward GGCCTTGGGGCTCATCATTG
  Reverse TTGAGGCCTCCGATCACTGT
  Probe TCAACCCTGCTGTGTCGCTGGCAGT